Restriction Enzymes
TelN Protelomerase (5 U/μL) - 14540ES
TelN Protelomerase is a recombinant expression from phage N15. It cuts double-stranded DNA (dsDNA) at TelN recognition sequences (56 bp), and generates covalently closed ends at the cleavage sites, which can be applied to enzymatic synthesis of DNA.
Packaging size: 50 μL, 200 μL and 1 mL
Unit Definition: One unit is defined as the amount of enzyme that will convert 0.5 μg of supercoiled plasmid containing telN recognition sites into closed linear dsDNA, in 20 μL reaction system containing 1 X TelN Reaction Buffer at 30℃ for 30 minutes.
Recognition Sites: TATCAGCACACAATTGCCCATTATACGC↓GCGTATAATGGACTATTGTGTGCTGATAATAGTCGTGTGTTAACGGGTAATATGCG↑CGCATATTACCTGATAACACACGACTAT
Heat Inactivation: 75℃ for 5 min
FuniCut™ PNGase F _20415ES
The PNGase F is a recombinant enzyme expressed in yeast, which can cleave high mannoses, heterozygotes, and complex oligosaccharide proteins linked by asparagine. The cleavage site of PNGase F is the amide bond between N-acetylglucosamine (GlcNAc) and asparagic acid residue on the inner side of the glycoprotein, and the aspartyl on the enzymatic hydrolysis protein is converted to aspartic acid. This product has a His tag and is often used for complete deglycosylation of antibodies and their related proteins.
Specifications:
- Source: Expressed in yeast
- Molecular weight: 36 kDa
- Specific activity: 750000 U/mL
- Buffer: 20 mM Tris-HCl pH 7.5, 50 mM NaCl, 5 mM EDTA,50% Glycerol
- Unit definition: One unit is defined as the amount of enzyme required to remove > 95% of the carbohydrate from 10 µg of denatured RNase B in 1 hour at 37°C in a total reaction volume of 10 µL
BspQI GMP-grade (10 U/μL) - 10664ES
This product is a type II restriction endonuclease derived from the recombinant protein encoded by the BspQI gene in Bacillus sphaericus expressed by E.coli. Its recognition sequence is 5'-GCTCTTCN1/N4-3'. Use to digest plasmids to prepare poly (A/T/G/C)-terminated linearized DNA fragments to obtain specific cohesive ends. This product is produced in accordance with GMP process requirements and provided in a liquid form.
Packaging size: 50 μL, 250 μL, 1 mL and 10 mL
Applications:
- Digest the plasmid to prepare a linearized DNA fragment at the end of Poly (A/T/C/G);- Linearize plasmid template before in vitro transcription- Restriction digest
Features:
- Type IIS restriction enzymes recognize asymmetric DNA sequences and cleave outside of their recognition sequence
- Restriction Enzyme Cut Site: GCTCTTC (1/4)
- Digestion of DNA to obtain specific sticky ends
- Isolated from a recombinant source
- Tested for the absence of endonucleases, exonucleases, RNases
FuniCut™ Bsa I GMP-grade -10661ES
This product is a type IIS restriction endonuclease derived from the recombinant protein encoded by the BsaI gene in Bacillus sphaericus expressed by E.coli. Its recognition sequence is 5'-GGTCTCN1/N5-3'. Use to digest plasmids to prepare poly(A/T/G/C)-terminated linearized DNA fragments to obtain specific cohesive ends.
This product is produced in accordance with GMP process requirements and provided in a liquid form. Packaging size: 50 μL, 500 μL and 5 mL Applications: - Digest the plasmid to prepare a linearized DNA fragment at the end of Poly (A/T/C/G); - Digestion of DNA to obtain specific sticky ends - Linearize plasmid template before in-vitro transcription
This product is produced in accordance with GMP process requirements and provided in a liquid form. Packaging size: 50 μL, 500 μL and 5 mL Applications: - Digest the plasmid to prepare a linearized DNA fragment at the end of Poly (A/T/C/G); - Digestion of DNA to obtain specific sticky ends - Linearize plasmid template before in-vitro transcription
Specifications:
- Expression host: Recombinant E. coli with BasI gene
- Reaction temperature: 37℃
- Storage Buffer: 10 mM Tris-HCl, 0.2 M NaCl, 0.1 mM EDTA, 1mM DTT, 50% Glycerol
- Unit definition: 1 unit is the amount of enzyme required to digest 1 μg of substrate DNA within 1 h at 37℃ in a 50 μL system.
FuniCut™ DpnI -15052ES
FuniCut™ enzymes are a series of engineered restriction enzymes that are capable of fast DNA digestion. All FuniCut™ enzymes show superior activity in the universal FuniCut™ Buffer and are able to digest DNA in 5~15 minutes. This enables any combination of restriction enzymes to work simultaneously in one reaction tube and eliminates the need for sequential digestions. FuniCut™ enzymes have passed multiple strict quality control steps, and can be used to digest plasmid, genomic and viral DNA as well as PCR products.
Packaging size: 50 μL (50 T)
Features: Applications:
- Rapid digestion: DNA was digested rapidly by enzyme for 5-15 min
- Universal buffer: one tube reaction, simplifying the process
- Stringent quality control
- Molecular cloning
- Southern blotting
- SNP
- Genotyping
Other molecular biology category products:
PCR Reagents
qPCR Reagents
Reverse Transcription
Cloning
DNA & RNA Extraction
Gene Editing
